Query (optional)   in Class  

GrainGenes Marker Report: Xabg387-1A.2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabg387-1A.2
Type
RFLP
Map
Tm-Dubcovsky2-1A21.7
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABG387
Remark
In the population 'T. monococcum, DV92 x G3116,' this locus and Xabg55-1A.2 were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous. Segregation data are listed under Xabg55-1A.2
Possible Orthologs
ABG387
[ Show all 14 ]



Probe for Locus
ABG387
Locus
ABG387a
[ Show all 15 ]
Synonym
SynonymHAR35_1739
Type
Genomic
STS
STS primers
5' GCACTGGCATAGTCTCACAA
5' CGATGCTGGTTCGGTCATAC
STS size
198
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
BH854352
ABG387-5
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03