Query (optional)   in Class  

GrainGenes Marker Report: Xabg500

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabg500
Type
RFLP
Chromosome
1A
Chromosome Arm
1AS
Map
1AS, T.m. G3116 x DV92-6.1
1BS, CS x CNN-10.8
Tm-Dubcovsky2-1A-4.1
TmTa-Dubcovsky-1A-7.6
[ Show Nearby Loci ]
Map Data
1AS, T.m. G3116 x DV92
1BS, CS x CNN
T. monococcum, DV92 x G3116
Triticum, CS-G1777 DS1A^m^(1A) RSL
Probe
ABG500
Possible Orthologs
ABG500
ABG500A
ABG500a-1H
ABG500b
ABG500b-4H



Probe for Locus
ABG500
Locus
ABG500A
[ Show all 6 ]
Synonym
SynonymHAR35_26354
External Databases
DDBJ
EMBL
GenBank
Type
Genomic
STS
PCR primers
GCTAGAACTTGACCAATCTC
AAGAAGAACCCGGAGAATCT
STS primers
5' ATTAATCCGACCGTCACTGC
5' ACGAACTCCTCGCTGCC
STS size
189
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AF309360
L44037
ABG500
ABG500-5
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
Kuenzel, Gottfried00.03