Query (optional)   in Class  

GrainGenes Marker Report: Xbarc1-5A

[Submit comment/correction]

Locus
Xbarc1-5A
Type
Microsatellite
Chromosome
5A
Map
Chinese_Spring_Deletion_SSR_5A0.46
CS/SQ1-5A29
T.b.xT.m.-5A18.7
Ta-Synthetic/Opata-BARC-5A34.2
[ Show Nearby Loci ]
Breakpoint Interval
5AL12-0.35-0.57
Map Data
T. boeoticum x monococcum
Wheat, Chinese Spring x SQ1
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC1
Possible Orthologs
Xbarc1
barc1
barc1-5A



Probe for Locus
BARC1
Locus
Xbarc1-5A
Xbarc1
barc1
barc1-5A
General Remarks
Contains motif : (TAA)8
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGATGCTTTTGCCTTGTTTCAG 3'
5' GCGGCCCCTTTGACTCTTCATAG 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211580
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.