Query (optional)   in Class  

GrainGenes Marker Report: Xbarc10-4B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc10-4B
Type
Microsatellite
Chromosome
4B
Map
Ta-Grandin/BR34-4B20
Ta-SSR-2004-4B53.7
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Grandin x BR34
Probe
BARC10
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc10-2B
[ Show all 8 ]



Probe for Locus
BARC10
Locus
Xbarc10-4B
[ Show all 9 ]
General Remarks
Contains motif : (GAA)13
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGTGCCACTGTAACCTTTAGAAGA 3'
5' GCGAGTTGGAATTATTTGAATTAAACAAG 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211581
Source Species
Triticum aestivum
Data Source
Ward, Rick