Query (optional)   in Class  

GrainGenes Marker Report: Xbarc127

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc127
Type
Microsatellite
Map
Ta-NxW-7A107.9
Wheat, Avalon x Cadenza 7A24.7
Wheat, UC1110 x PI610750 7A63.7
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Nanda2419 x Wangshuibai
Wheat, UC1110 x PI610750
Probe
BARC127
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs
Xbarc127-6B
Xbarc127-7A
barc127
barc127-7A
barc127-6B



Probe for Locus
BARC127
Locus
Xbarc127-7A
[ Show all 6 ]
General Remarks
Contains motif : (CT)19
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' TGCATGCACTGTCCTTTGTATT 3'
5' AAGATGCGGGCTGTTTTCTA 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211328
Source Species
Triticum aestivum
Data Source
Ward, Rick