Query (optional)   in Class  

GrainGenes Marker Report: Xbarc141-6B

[Submit comment/correction]

Locus
Xbarc141-6B
Type
Microsatellite
Map Data
Wheat, Consensus SSR, 2004
Probe
BARC141
Possible Orthologs
Xbarc141
Xbarc141-5A
Xbarc141.1-5A
barc141
barc141-5A



Probe for Locus
BARC141
Locus
Xbarc141-5A
[ Show all 6 ]
General Remarks
Contains motif : (GA)11
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GGCCCATGGATAATTTTTGAAATG 3'
5' CAATTCGGCCAAAGAAGAAGTCA 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211625
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.