Query (optional)   in Class  

GrainGenes Marker Report: Xbarc146-6D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc146-6D
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_6D0.145
[ Show Nearby Loci ]
Breakpoint Interval
C-6DL6-0.29
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC146
Possible Orthologs
Xbarc146
[ Show all 7 ]



Probe for Locus
BARC146
Locus
Xbarc146-6B
[ Show all 8 ]
General Remarks
Contains motif : (CT)21
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' AAGGCGATGCTGCAGCTAAT 3'
5' GGCAATATGGAAACTGGAGAGAAAT 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211331
Source Species
Triticum aestivum
Data Source
Ward, Rick