Query (optional)   in Class  

GrainGenes Marker Report: Xbarc152-1B

[Submit comment/correction]

Locus
Xbarc152-1B
Type
Microsatellite
Map
CS/SQ1-1B17.1
[ Show Nearby Loci ]
Map Data
Wheat, Chinese Spring x SQ1
Probe
BARC152
Possible Orthologs
Xbarc152
[ Show all 10 ]



Probe for Locus
BARC152
Locus
Xbarc152-1B
[ Show all 12 ]
General Remarks
Contains motif : (ATT)23
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' CTTCCTAAAATCGGGCAACCGCTTGTTG 3'
5' GCGTAATGATGGGAGTGGCTATAGGGCAGTT 3'
Amplification Conditions
Annealing temperature = 50
Sequence
BV211514
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.