Query (optional)   in Class  

GrainGenes Marker Report: Xbarc153-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc153-4A
Type
Microsatellite
Chromosome
4A
Map
Chinese_Spring_Deletion_SSR_4A0.9
Ta-Synthetic/Opata-BARC-4A116.8
[ Show Nearby Loci ]
Breakpoint Interval
4AL4-0.80-1.00
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC153
Possible Orthologs
Xbarc153
Xbarc153-7D



Probe for Locus
BARC153
Locus
Xbarc153-7D
Xbarc153-4A
Xbarc153
General Remarks
Contains motif : (TAA)34
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' CGCGCCTTGCTTTATTAGTATTAGTATT 3'
5' GCGGCATGCACATATAATTCTCATTGACT 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211631
Source Species
Triticum aestivum
Data Source
Ward, Rick