Query (optional)   in Class  

GrainGenes Marker Report: Xbarc165-6A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc165-6A
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_6A0.45
[ Show Nearby Loci ]
Breakpoint Interval
C-6AL8-0.90*
Map Data
Wheat, Physical, SSR
Probe
BARC165
Possible Orthologs
Xbarc165
[ Show all 13 ]



Probe for Locus
BARC165
Locus
Xbarc165-5A
[ Show all 14 ]
General Remarks
Contains motif : (ATT)19
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGTAGAGCGGCTGTTAGTGTCAAATTA 3'
5' GCGTTATCTCAAGTTTTGTAGCAGA 3'
Amplification Conditions
Annealing temperature = 50
Sequence
BV211523
Source Species
Triticum aestivum
Data Source
Ward, Rick