Query (optional)   in Class  

GrainGenes Marker Report: Xbarc170-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc170-4A
Type
Microsatellite
Chromosome
4A
Map
Chinese_Spring_Deletion_SSR_4A0.625
Kofa/UC1113-4A46.2
Ta-SSR-2004-4A26.6
Ta-Synthetic/Opata-BARC-4A47.6
[ Show Nearby Loci ]
Breakpoint Interval
4AL13-0.59-0.66
Map Data
Durum wheat, Kofa x UC1113
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC170
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc170
barc170
barc170-4A



Probe for Locus
BARC170
Locus
Xbarc170-4A
Xbarc170
Phs1
barc170
barc170-4A
General Remarks
Contains motif : (ATT)28
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' CGCTTGACTTTGAATGGCTGAACA 3'
5' CGCCCACTTTTTACCTAATCCTTTTGAA 3'
Amplification Conditions
Annealing temperature = 50
Sequence
BV211529
Source Species
Triticum aestivum
Data Source
Ward, Rick