Query (optional)   in Class  

GrainGenes Marker Report: Xbarc174-7A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc174-7A
Type
Microsatellite
Chromosome
7A
Map
CS/SQ1-7A99.1
Kofa/UC1113-7A74.3
P91193D1/P92201D5-7A132.9
Ta-SSR-2004-7A64
[ Show Nearby Loci ]
Map Data
Durum wheat, Kofa x UC1113
Wheat, Chinese Spring x SQ1
Wheat, Consensus SSR, 2004
Wheat, P91193D1 x P92201D5
Probe
BARC174
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc174
[ Show all 7 ]



Probe for Locus
BARC174
Locus
Xbarc174-7A
[ Show all 8 ]
General Remarks
Contains motif : (ATT)9
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' TGGCATTTTTCTAGCACCAATACAT 3'
5' GCGAACTGGACCAGCCTTCTATCTGTTC 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211633
Source Species
Triticum aestivum
Data Source
Ward, Rick