Query (optional)   in Class  

GrainGenes Marker Report: Xbarc182-7B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc182-7B
Type
Microsatellite
Chromosome
7B
Map
Chinese_Spring_Deletion_SSR_7B0.5
Conan/Reeder-7B125.36
P91193D1/P92201D5-7B160.4
Ta-SSR-2004-7B143.7
Ta-Synthetic/Opata-BARC-7B121.5
[ Show Nearby Loci ]
Breakpoint Interval
C-7BL-0.00-1.00*
Map Data
Wheat, Conan x Reeder
Wheat, Consensus SSR, 2004
Wheat, P91193D1 x P92201D5
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC182
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc182
barc182
barc182-7B



Probe for Locus
BARC182
Locus
Xbarc182-7B
Xbarc182
barc182
barc182-7B
General Remarks
Contains motif : (CT)15
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' CCATGGCCAACAGCTCAAGGTCTC 3'
5' CGCAAAACCGCATCAGGGAAGCACCAAT 3'
Amplification Conditions
Annealing temperature = 58
Sequence
BV211826
Source Species
Triticum aestivum
Data Source
Ward, Rick