Query (optional)   in Class  

GrainGenes Marker Report: Xbarc187-1B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc187-1B
Type
Microsatellite
Chromosome
1B
Map
Chinese_Spring_Deletion_SSR_1B0.16
P91193D1/P92201D5-1B182.1
Ta-SSR-2004-1B31.5
Ta-Synthetic/Opata-BARC-1B34.5
[ Show Nearby Loci ]
Breakpoint Interval
C-1BL6-0.32
Map Data
Wheat, Consensus SSR, 2004
Wheat, P91193D1 x P92201D5
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Probe
BARC187
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc187
barc187
barc187-1B



Probe for Locus
BARC187
Locus
Xbarc187
Xbarc187-1B
Yr24
barc187
barc187-1B
General Remarks
Contains motif : (CT)26
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GTGGTATTTCAGGTGGAGTTGTTTTA 3'
5' CGGAGGAGCAGTAAGGAAGG 3'
Amplification Conditions
Annealing temperature = 55
Sequence
BV211754
Source Species
Triticum aestivum
Data Source
Ward, Rick