Query (optional)   in Class  

GrainGenes Marker Report: Xbarc20-4B

[Submit comment/correction]

Locus
Xbarc20-4B
Type
Microsatellite
Chromosome
4B
Map
Chinese_Spring_Deletion_SSR_4B-0.69
Ta-SSR-2004-4B21.6
[ Show Nearby Loci ]
Breakpoint Interval
4BS8-0.57-0.81
Map Data
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Probe
BARC20
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xbarc20
Xbarc20-7B
barc20
barc20-4B
barc20-7B



Probe for Locus
BARC20
Locus
Xbarc20
[ Show all 6 ]
General Remarks
Contains motif : (TAA)21
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGATCCACACTTTGCCTCTTTTACA 3'
5' GCGATGTCGGTTTTCAGCCTTTT 3'
Amplification Conditions
Annealing temperature = 53
Sequence
BV211638
Source Species
Triticum aestivum
Data Source
Ward, Rick

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.