Query (optional)   in Class  

GrainGenes Marker Report: Xbarc73-3B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbarc73-3B
Type
Microsatellite
Chromosome
3B
Chromosome Arm
3BS
Map
Chinese_Spring_Deletion_SSR_3B-0.45
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
3BS-1/3BS-2
3BS1-0.33-0.57
Map Data
Durum wheat, Kofa x UC1113
[ Show all 6 ]
Probe
BARC73
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceLiu SX and Anderson JA (2003) Marker assisted evaluation of Fusarium head blight resistant wheat germplasm Crop Science 43:760-766.



Probe for Locus
BARC73
Locus
Xbarc73-3B
Xbarc73
barc73-3B
barc73
BARC73
General Remarks
Contains motif : (GA)4(TAGA)4(TAGAGA)2(GA)12
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCGTGTCGTGCTTGTTCTCGGTTCTCAG 3'
5' CGCTATTTGCCGCCACCTCCATCA 3'
Amplification Conditions
Annealing temperature = 60
Sequence
BV211850
Source Species
Triticum aestivum
Data Source
Ward, Rick