Query (optional)   in Class  

GrainGenes Marker Report: Xbcd263

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xbcd263
Type
RFLP
Map
Avena-Sorrells-C40.2
[ Show Nearby Loci ]
Map Data
Diploid Oat, Cornell2
Probe
BCD263
Homology
T46636e-value: 0.11glycine dehydrogenase (decarboxylating) (EC 1.4.4.2) [imported] - Hordeum sp. x Triticum sp
T46636e-value: 3e-71glycine dehydrogenase (decarboxylating) (EC 1.4.4.2) [imported] - Hordeum sp. x Triticum sp
T46636e-value: 2e-46glycine dehydrogenase (decarboxylating) (EC 1.4.4.2) [imported] - Hordeum sp. x Triticum sp
Possible Orthologs
BCD263
BCD0263a



Probe for Locus
BCD263
Locus
BCD263
Xbcd263
BCD0263a
Synonym
SynonymHAR35_259
HAR35_50908
Reference
ReferenceHeun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
General Remarks
Lambda ZAP II library
Bar.LambZAPII [c]
Type
cDNA
STS
STS primers
5' CCGTTACCTGCACAAGTTGC
5' ACATTTCGGTGGTGGTCTCC
STS size
ca. 500
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
BE438624
[ Show all 7 ]
Polymorphism
BCD263 EcoRI
Linkage Group
3L
Insert Enzyme
EcoRI
Source Species
Hordeum vulgare
Source Germplasm
Willis
Source Tissue
etiolated leaf
Insert Size
1.8
Clone Vector
pBluSK
pBluSK-
Excision Enzyme
EcoRI
Vector PCR primers
M13forward
M13reverse
Vector Amplification
94 C for 78 sec, 50 C 78 sec, 72 C 120 sec, 25 times; 94 C for 78 sec, 50 C 78 sec, 72 C 5 min, 1 time
Antibiotic
Ampicillin
Clone Location
Sorrells, Mark E.
GrainGenes Probe Repository
Clone Authority
Sorrells, Mark E.
Data Source
Sorrells, Mark E.96.07
ATMI92.09
Kuenzel, Gottfried00.03