Query (optional)   in Class  

GrainGenes Marker Report: Xcfa2040-7D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfa2040-7D
Type
Microsatellite
Chromosome
7D
Map
Chinese_Spring_Deletion_SSR_7D0.91
Ta-Courtot/CS-GPW-7D256.2
Ta-SSR-2004-7D144
[ Show Nearby Loci ]
Breakpoint Interval
7DL3-0.82-1.00
Map Data
Wheat, Consensus SSR, 2004
Wheat, Courtot x Chinese Spring, GPW
Wheat, Physical, SSR
Probe
CFA2040
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfa2040
[ Show all 23 ]



Probe for Locus
CFA2040
Locus
Xcfa2040
[ Show all 25 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CA)16
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TCAAATGATTTCAGGTAACCACTA 3'
Reverse 5' TTCCTGATCCCACCAAACAT 3'
SSR size
286
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A/7D
Source Species
Triticum urartu
Data Source
Sourdille, Pierre