Query (optional)   in Class  

GrainGenes Marker Report: Xcfa2147-1B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfa2147-1B
Type
Microsatellite
Chromosome
1B
Map
Chinese_Spring_Deletion_SSR_1B0.845
Ta-SSR-2004-1B74.9
[ Show Nearby Loci ]
Breakpoint Interval
1BL2-0.69-1.00*
Map Data
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Probe
CFA2147
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfa2147-1A
[ Show all 11 ]



Probe for Locus
CFA2147
Locus
Xcfa2147a
[ Show all 12 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CATC)4
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TCATCCCCTACATAACCCGA 3'
Reverse 5' ATCGTGCACCAAGCAATACA 3'
SSR size
291
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
1B/1D/1B
Source Species
Triticum urartu
Data Source
Sourdille, Pierre