Query (optional)   in Class  

GrainGenes Marker Report: Xcfa2174-7D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfa2174-7D
Type
Microsatellite
Chromosome
7D
Chromosome Arm
7DS
Map
Chinese_Spring_Deletion_SSR_7D0.15
Ta-Synthetic/Opata-GPW-7D125
Triticum-AxF-7D116.8
Wheat, UC1110 x PI610750 7D107.2
[ Show Nearby Loci ]
Breakpoint Interval
C-7DL5-0.30
Map Data
Wheat, Arina x Forno
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Wheat, UC1110 x PI610750
Species
Triticum aestivum
Probe
CFA2174
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xcfa2174
[ Show all 8 ]



Probe for Locus
CFA2174
Locus
Xcfa2174-4A
[ Show all 9 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CT)15(GT)14
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' ACGGCATCACAGGTTAAAGG 3'
Reverse 5' GGTCTTTGCACTGCTAGCCT 3'
SSR size
191
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A/3D/7D
Source Species
Triticum urartu
Data Source
Sourdille, Pierre