Query (optional)   in Class  

GrainGenes Marker Report: Xcfa2190-5A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfa2190-5A
Type
Microsatellite
Chromosome
5A
Map
Ta-SSR-2004-5A44
Ta-Synthetic/Opata-GPW-5A34.3
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, GPW
Probe
CFA2190
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfa2190
cfa2190



Probe for Locus
CFA2190
Locus
Xcfa2190-5A
Xcfa2190
cfa2190
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TC)31
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' CAGTCTGCAATCCACTTTGC 3'
Reverse 5' AAAAGGAAACTAAAGCGATGGA 3'
SSR size
169
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
5A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre