Query (optional)   in Class  

GrainGenes Marker Report: Xcfa2262-3A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfa2262-3A
Type
Microsatellite
Chromosome
3A
Chromosome Arm
3AL
Map
CS/SQ1-3A93.6
Ta-SSR-2004-3A64.4
Ta-Synthetic/Opata-GPW-3A66
Triticum-AxF-3A97.5
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Wheat, Chinese Spring x SQ1
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, GPW
Species
Triticum aestivum
Probe
CFA2262
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xcfa2262
[ Show all 6 ]



Probe for Locus
CFA2262
Locus
Xcfa2262-3A
[ Show all 7 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TG)17
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' ACAATGTGGAGATGGCACAA 3'
Reverse 5' TACCAGCTGCACTTCCATTG 3'
SSR size
172
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
2D/3A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre