Query (optional)   in Class  

GrainGenes Marker Report: Xcfb3034-3B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfb3034-3B
Chromosome
3B
Chromosome Arm
3BS
Map
Chinese_Spring_Deletion_SSR_3B-0.44
[ Show Nearby Loci ]
Breakpoint Interval
3BS1-0.33-0.55
Map Data
Wheat, Physical, SSR
Probe
CFB3034
Data Source
Sourdille, Pierre2006.03



Probe for Locus
CFB3034
Locus
Xcfb3034-3B
Synonym
Other nameCFT3034
General Remarks
Motif (TTTG)3
Type
Genomic
PCR
SSR
PCR primers
Forward TCACCGCACGTGCACAGC
Reverse CCTCTTTCAATCCAATCCACC
TCACCGCACGTGCACAGC
CCTCTTTCAATCCAATCCACC
SSR size
253
Amplification Conditions
Tm 60
Sequence
3B_007_O05_RM1
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
DNA Origin
Chromosome 3B BAC ends
Data Source
Sourdille, Pierre2006.03
Sourdille, Pierre2006.10