Query (optional)   in Class  

GrainGenes Marker Report: Xcfb3232-3B.1

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfb3232-3B.1
Chromosome
3B
Chromosome Arm
3BL
Map
Chinese_Spring_Deletion_SSR_3B0.565
[ Show Nearby Loci ]
Breakpoint Interval
3BL10-0.50-0.63
Map Data
Wheat, Physical, SSR
Probe
CFB3232
Data Source
Sourdille, Pierre2006.03



Probe for Locus
CFB3232
Locus
Xcfb3232-3B.2
Xcfb3232-3B.1
Synonym
Other nameCFT3232
General Remarks
Motif (AT)7
Type
Genomic
PCR
SSR
PCR primers
Forward TGAGTTAATAGGACGTGGGG
Reverse CACACAGCTCAGTTCTTTTTTC
TGAGTTAATAGGACGTGGGG
CACACAGCTCAGTTCTTTTTTC
SSR size
269
Amplification Conditions
Tm 60
Sequence
3B_055_N05_FM1
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
DNA Origin
Chromosome 3B BAC ends
Data Source
Sourdille, Pierre2006.03
Sourdille, Pierre2006.10