Query (optional)   in Class  

GrainGenes Marker Report: Xcfd101

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd101
Type
Microsatellite
Chromosome
5D
Map
Wheat-Composite2004-5D49
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
CFD101
Possible Orthologs
Xcfd101-5D



Probe for Locus
CFD101
Locus
Xcfd101-5D
Xcfd101
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = D
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CGG)5
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TCGACCGAAGAGAGCAGAAT 3'
Reverse 5' AGAATGCGTCCTTTTCTTGC 3'
SSR size
299
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
5D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre