Query (optional)   in Class  

GrainGenes Marker Report: Xcfd14-7D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd14-7D
Type
Microsatellite
Chromosome
7D
Map
Chinese_Spring_Deletion_SSR_7D-0.18
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-7DS5-0.36
Map Data
Wheat, Chinese Spring x SQ1
[ Show all 6 ]
Probe
CFD14
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfd14
cfd14-7D



Probe for Locus
CFD14
Locus
Xcfd14-7D
Xcfd14
cfd14-7D
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TC)28
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CCACCGGCCAGAGTAGTATT 3'
Reverse 5' TCCTGGTCTAACAACGAGAAGA 3'
SSR size
152
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre