Query (optional)   in Class  

GrainGenes Marker Report: Xcfd193

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd193
Type
Microsatellite
Chromosome
4D
Map
Wheat-Composite2004-4D39
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
CFD193
Possible Orthologs
Xcfd193-2D
[ Show all 11 ]



Probe for Locus
CFD193
Locus
Xcfd193-4D
[ Show all 12 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = D
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GT)16
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' GCTGCCGCTACTGTCTGTC 3'
Reverse 5' GGCACACTCACACACCACAC 3'
SSR size
199
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
4D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre