Query (optional)   in Class  

GrainGenes Marker Report: Xcfd257-4A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd257-4A
Type
Microsatellite
Chromosome
4A
Map
Ta-SSR-2004-4A51.3
Ta-Synthetic/Opata-GPW-4A107.2
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, GPW
Probe
CFD257
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xcfd257
cfd257



Probe for Locus
CFD257
Locus
Xcfd257-4A
Xcfd257
cfd257
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = C
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GAA)6
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' TCTCAACTTGCAACTGCCAC 3'
Reverse 5' CCCTCCATGGATTCTTGCTA 3'
SSR size
287
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
4A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre