Query (optional)   in Class  

GrainGenes Marker Report: Xcfd4-3B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd4-3B
Type
Microsatellite
Chromosome
3B
Chromosome Arm
3BL
Map
Ta-Courtot/CS-GPW-3B98.3
Ta-SSR-2004-3B63.4
Ta-Synthetic/Opata-GPW-3B78.3
Triticum-AxF-3B70.4
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Wheat, Consensus SSR, 2004
Wheat, Courtot x Chinese Spring, GPW
Wheat, Synthetic x Opata, GPW
Species
Triticum aestivum
Probe
CFD4
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
cfd4
[ Show all 8 ]



Probe for Locus
CFD4
Locus
Xcfd4-3B
[ Show all 9 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TC)37
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TGCTCCGTCTCCGAGTAGAT 3'
Reverse 5' GGGAAGGAGAGATGGGAAAC 3'
SSR size
262
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3D/3B
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre