Query (optional)   in Class  

GrainGenes Marker Report: Xcfd6-2A

[Submit comment/correction]

Locus
Xcfd6-2A
Type
Microsatellite
Chromosome
2A
Map
Ta-SSR-2004-2A65
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
CFD6
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
cfd6
[ Show all 9 ]



Probe for Locus
CFD6
Locus
Xcfd6-7A
[ Show all 10 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = D
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)6(GCTA)4
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' ACTCTCCCCCTCGTTGCTAT 3'
Reverse 5' ATTTAAGGGAGACATCGGGC 3'
SSR size
236
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.