Query (optional)   in Class  

GrainGenes Marker Report: Xcfd79-3D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd79-3D
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_3D-0.775
Ta-Courtot/CS-GPW-3D53.6
[ Show Nearby Loci ]
Breakpoint Interval
3DS6-0.55-1.00
Map Data
Wheat, Consensus SSR, 2004
Wheat, Courtot x Chinese Spring, GPW
Wheat, Physical, SSR
Probe
CFD79
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
cfd79
[ Show all 15 ]



Probe for Locus
CFD79
Locus
Xcfd79-3B
[ Show all 16 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = D
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)26
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TCTGGTTCTTGGGAGGAAGA 3'
Reverse 5' CATCCAACAATTTGCCCAT 3'
SSR size
284
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3D/3B
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre