Query (optional)   in Class  

GrainGenes Marker Report: Xcfd79b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd79b
Type
Microsatellite
Chromosome
3B
Map
Wheat-Composite2004-3B17
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
CFD79
Possible Orthologs
cfd79
[ Show all 15 ]



Probe for Locus
CFD79
Locus
Xcfd79-3B
[ Show all 16 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = D
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)26
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TCTGGTTCTTGGGAGGAAGA 3'
Reverse 5' CATCCAACAATTTGCCCAT 3'
SSR size
284
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3D/3B
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre