Query (optional)   in Class  

GrainGenes Marker Report: Xcfd92-1D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcfd92-1D
Type
Microsatellite
Chromosome
1D
Chromosome Arm
1DS
Map
Ta-SSR-2004-1D33.1
Ta-Synthetic/Opata-GPW-1D45.5
Triticum-AxF-1D42
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, GPW
Species
Triticum aestivum
Probe
CFD92
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xcfd92
cfd92
cfd92-1D



Probe for Locus
CFD92
Locus
Xcfd92-1D
Xcfd92
cfd92
cfd92-1D
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = A
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CT)21(A)19
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' CTTGTTGATCTCCTTCCCCA 3'
Reverse 5' TTCTCTCATGACGGCAACAC 3'
SSR size
253
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
1D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre