Query (optional)   in Class  

GrainGenes Marker Report: Xcmwg669-6B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcmwg669-6B
Type
RFLP
Chromosome
6B
Map
Tturgidum-Du-6B22.3
[ Show Nearby Loci ]
Map Data
T. turgidum, durum x dicoccoides
Probe
cMWG669
Possible Orthologs
cMWG669
[ Show all 8 ]



Probe for Locus
cMWG669
Locus
Xcmwg669-6
[ Show all 15 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
5' CTTGCTCGGTTGACTGTGTT
5' GCTGCGGCACCTGAGTTAAA
STS size
499
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234413
AJ234412
cMWG669
CMWG669-5
CMWG669-3
Linkage Group
6H
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
2
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Stein, Nils2006.10
Kuenzel, Gottfried00.03