Query (optional)   in Class  

GrainGenes Marker Report: Xcmwg706-1A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcmwg706-1A
Type
RFLP
Chromosome
1A
Chromosome Arm
1AL
Map
Ta-Synthetic/Opata-1A105
Ta-Synthetic/Opata-BARC-1A75.4
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata  [ GBrowser ]
Wheat, Synthetic x Opata, BARC
Probe
cMWG706
Possible Orthologs
cMWG706
[ Show all 6 ]



Probe for Locus
cMWG706
Locus
cMWG706A
[ Show all 7 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
5' GGGCAAGACTGTGCTGGAGC
5' CCAGTGGATTTGTACTGCAC
STS size
ca. 1200
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234432
CMWG706-5
Linkage Group
1H
Barley 1 (7H)
Barley 5 (1H)
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
0.75
0.8
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Stein, Nils2006.10
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03