Query (optional)   in Class  

GrainGenes Marker Report: Xcnl5a

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcnl5a
Type
Microsatellite
Chromosome
1A
Map
Wheat-Composite2004-1A96
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
AG10



Probe for Locus
AG10
Locus
Xcnl5-1A
Xcnl5
Xcnl5a
Xcnl5b
Reference
ReferenceMa ZQ et al. (1996) Frequencies and sequence characteristics of di-, tri-, and tetranucleotide microsatellites in wheat. Genome 39:123-130.
General Remarks
Repeat sequences (CT)13
Product size 129 in Geneva PI505819
Type
PCR
SSR
PCR primers
GGTGATGAGTGGCACAGG
CCCAACAGTTGCAGAAAATTAG
Amplification Conditions
Annealing temperature 52 C, 1.50 mM MgCl2
Source Species
Triticum aestivum
Clone Authority
Sorrells, Mark E.
Blake, Tom
Data Source
Sorrells, Mark E.95.09.13
Blake, Tom95.08.24