Query (optional)   in Class  

GrainGenes Marker Report: Xcnl6b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcnl6b
Type
Microsatellite
Chromosome
2B
5A
7D
Map
Wheat-Composite2004-2B78
Wheat-Composite2004-5A0
Wheat-Composite2004-7D77
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
AG24
Possible Orthologs
Xcnl6
[ Show all 7 ]



Probe for Locus
AG24
Locus
Xcnl6-2B
[ Show all 8 ]
Reference
ReferenceMa ZQ et al. (1996) Frequencies and sequence characteristics of di-, tri-, and tetranucleotide microsatellites in wheat. Genome 39:123-130.
General Remarks
Repeat sequences (TC)17C2(TC)6(C)2(TC)9
Product size 204 in Geneva PI505819
Type
PCR
SSR
PCR primers
GGACGAATGAAAAATTCCCAGG
GAGCGGTCTTCGGACTTTC
Amplification Conditions
Annealing temperature 50 C, 2.50 mM MgCl2
Source Species
Triticum aestivum
Clone Authority
Sorrells, Mark E.
Blake, Tom
Data Source
Sorrells, Mark E.95.09.13
Blake, Tom95.08.24