Query (optional)   in Class  

GrainGenes Marker Report: Xcsb112(Dhn5)-6B

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xcsb112(Dhn5)-6B
Type
RFLP
STS
Synonym
Other nameXDhn5-6B
ReferenceChen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.
Chromosome
6B
Chromosome Arm
6BL
Map
Tturgidum-Du-6B22.3
[ Show Nearby Loci ]
Map Data
T. turgidum, durum x dicoccoides
Species
Triticum turgidum
Probe
Dhn5
pHv5
ReferenceBartels D and Thompson RD (1983) The characterization of cDNA clones coding for wheat storage proteins. Nucleic Acids Research 11:2961-2977.
Reference
ReferenceChen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.
Possible Orthologs
dhn5
[ Show all 15 ]



Probe for Locus
Dhn5
Locus
Xcsb112(Dhn5)-6A
[ Show all 16 ]
Synonym
Other nameHV5
pHv5
Reference
ReferenceChoi DW et al. (2000) Map locations of barley Dhn genes determined by gene-specific PCR Theoretical and Applied Genetics 101:350-354.
ReferenceClose TJ et al. (1989) A cDNA-based comparison of dehydration-induced proteins (dehydrins) in barley and corn. Plant Molecular Biology 13:95-108.
General Remarks
Size in Dicktoo (bp) = 1157
Size in Morex (bp) = 1449
Type
cDNA
PCR
STS
PCR primers
5' AGCAGCGCTTGTAGATATTCCCGA
3' CTCCACCAACGAAAGTGAGCTAGG
Amplification Conditions
Annealing temp. = 62
Sequence
M95810
Source Gene Class
Dehydrin
Source Species
Hordeum vulgare
Clone Location
Close, Timothy J.
Information Source
ReferenceChen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.



Probe for Locus
pHv5
Locus
Xcsb112(Dhn5)-6A
Xcsb112(Dhn5)-6B
Synonym
Please seeDhn5
General Remarks
This name is superseded.
Data Source
Close, Timothy J.97.10