Query (optional)   in Class  

GrainGenes Marker Report: Xgdm113-6B

[Submit comment/correction]

Locus
Xgdm113-6B
Type
Microsatellite
Chromosome
6B
Map
Ta-SSR-2004-6B26.6
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
GDM113
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePestsova E et al. (2000) Isolation and mapping of microsatellite markers specific for the D genome of bread wheat Genome 43:689-697.
Possible Orthologs
Xgdm113
gdm113-6B
gdm113



Probe for Locus
GDM113
Locus
Xgdm113-6B
Xgdm113
gdm113-6B
gdm113
General Remarks
Repeat sequence: (GA)9GG(GA)6
Type
PCR
SSR
PCR primers
Left ACCCATCTGATATTTTGGGG
Right AAAATGCCCTTCCCAACC
Amplification Conditions
Tm = 55 C
Source Species
Aegilops tauschii

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.