Query (optional)   in Class  

GrainGenes Marker Report: Xgdm138

[Submit comment/correction]

Locus
Xgdm138
Type
Microsatellite
Map
Ta-NxW-5D86.8
[ Show Nearby Loci ]
Map Data
Wheat, Nanda2419 x Wangshuibai
Probe
GDM138
Possible Orthologs
Xgdm138-5B
Xgdm0138-5D
Xgdm138-5D
gdm138
gdm138-5D



Probe for Locus
GDM138
Locus
Xgdm138-5D
[ Show all 6 ]
General Remarks
Repeat sequence: (CT)44 imp.
Type
PCR
SSR
PCR primers
Left CATGAGCCGATTCAGCG
Right CGCTTAAATTGAAGTACCGC
Amplification Conditions
Tm = 50 C
Source Species
Aegilops tauschii

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.