Query (optional)   in Class  

GrainGenes Marker Report: Xgdm138-5D

[Submit comment/correction]

Locus
Xgdm138-5D
Type
Microsatellite
Chromosome
5D
Chromosome Arm
5DL
Map
Chinese_Spring_Deletion_SSR_5D0.3
Ta-SSR-2004-5D37.8
Ta-Synthetic/Opata-GPW-5D60.7
Ta-Synthetic/Opata-SSR_D-5D61.2
[ Show Nearby Loci ]
Breakpoint Interval
C-5DL1-0.60
Map Data
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR-D
Probe
GDM138
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePestsova E et al. (2000) Isolation and mapping of microsatellite markers specific for the D genome of bread wheat Genome 43:689-697.
Possible Orthologs
Xgdm138
Xgdm138-5B
Xgdm0138-5D
gdm138
gdm138-5D



Probe for Locus
GDM138
Locus
Xgdm138-5D
[ Show all 6 ]
General Remarks
Repeat sequence: (CT)44 imp.
Type
PCR
SSR
PCR primers
Left CATGAGCCGATTCAGCG
Right CGCTTAAATTGAAGTACCGC
Amplification Conditions
Tm = 50 C
Source Species
Aegilops tauschii

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.