Query (optional)   in Class  

GrainGenes Marker Report: Xgdm3-5D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgdm3-5D
Type
Microsatellite
Chromosome
5D
Chromosome Arm
5DL
Map
Conan/Reeder-5D5.18566
Ta-Synthetic/Opata-GPW-5D23.1
Ta-Synthetic/Opata-SSR_D-5D21.9
[ Show Nearby Loci ]
Map Data
Wheat, Conan x Reeder
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR-D
Probe
GDM3
Reference
ReferencePestsova E et al. (2000) Isolation and mapping of microsatellite markers specific for the D genome of bread wheat Genome 43:689-697.
Possible Orthologs
Xgdm3-5B



Probe for Locus
GDM3
Locus
Xgdm3-5D
Xgdm3-5B
General Remarks
Repeat sequence: (GT)15
Type
PCR
SSR
PCR primers
Left GTATCTCGGTGATGCAGCAA
Right GTGTGATGTTTGAATACGCA
Amplification Conditions
Tm = 55 C
Source Species
Aegilops tauschii