Query (optional)   in Class  

GrainGenes Marker Report: Xgdm35-2D

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgdm35-2D
Type
Microsatellite
Chromosome
2D
Chromosome Arm
2DS
Map
Chinese_Spring_Deletion_SSR_2D-0.735
Ta-Synthetic/Opata-SSR_D-2D15.7
Triticum-AxF-2D4.7
[ Show Nearby Loci ]
Breakpoint Interval
2DS5-0.47-1.00
Map Data
Wheat, Arina x Forno
Wheat, Physical, SSR
Wheat, Synthetic x Opata, SSR-D
2 Point Data
Lr39/Xgdm35Distance: 0.9 cM
Species
Triticum aestivum
Probe
GDM35
Reference
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferencePestsova E et al. (2000) Isolation and mapping of microsatellite markers specific for the D genome of bread wheat Genome 43:689-697.



Probe for Locus
GDM35
Locus
Xgdm35-2D
Lr39
General Remarks
Repeat sequence: (CA)26
Type
PCR
SSR
PCR primers
Left CCTGCTCTGCCCTAGATACG
Right ATGTGAATGTGATGCATGCA
Amplification Conditions
Tm = 55 C
Source Species
Aegilops tauschii