Query (optional)   in Class  

GrainGenes Marker Report: Xgpw1100-7A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw1100-7A
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_7A0.725
Ta-Synthetic/Opata-GPW-7A157.5
[ Show Nearby Loci ]
Breakpoint Interval
7AL17-0.71-0.74
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Probe
GPW1100
Possible Orthologs
Xgpw1100-7B
Xgpw1100a



Probe for Locus
GPW1100
Locus
Xgpw1100-7A
Xgpw1100-7B
Xgpw1100a
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GT)21
Type
PCR
SSR
PCR primers
Forward AGGAATAGTCCTTCTCCCGC
Reverse GCCACCTTCTTATTCATGGC
SSR size
Expected 150
Amplification Conditions
Tm = 60C
Linkage Group
7A/7B
Source Species
Aegilops speltoides
Triticum aestivum
Data Source
Sourdille, Pierre2009.09