Query (optional)   in Class  

GrainGenes Marker Report: Xgpw2107-7A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw2107-7A
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_7A-0.945
Ta-Synthetic/Opata-GPW-7A0.1
[ Show Nearby Loci ]
Breakpoint Interval
7AS1-0.89-1.00
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Probe
GPW2107
Possible Orthologs
Xgpw2107



Probe for Locus
GPW2107
Locus
Xgpw2107-7A
Xgpw2107
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CT)35
Type
PCR
SSR
PCR primers
Forward CGTGAGGCATGTGAGAAGAA
Reverse TTGAGGAACATGGCTAAGGG
SSR size
Expected 189
Amplification Conditions
Tm = 60C
Linkage Group
7A
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09