Query (optional)   in Class  

GrainGenes Marker Report: Xgpw2127-2A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw2127-2A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-2A69
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW2127
Possible Orthologs
Xgpw2127



Probe for Locus
GPW2127
Locus
Xgpw2127-2A
Xgpw2127
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (GA)22
Type
PCR
SSR
PCR primers
Forward GACAACACCGATCCGTCAC
Reverse TGTCCATGCGTTCTATTCCA
SSR size
Expected 253
Amplification Conditions
Tm = 60C
Linkage Group
2A
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09