Query (optional)   in Class  

GrainGenes Marker Report: Xgpw2225b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw2225b
Type
Microsatellite
Chromosome
2B
Map
Wheat-Composite2004-2B65
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
GPW2225
Possible Orthologs
Xgpw2225-2A
Xgpw2225-2B
Xgpw2225a



Probe for Locus
GPW2225
Locus
Xgpw2225-2A
Xgpw2225-2B
Xgpw2225a
Xgpw2225b
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CA)22
Type
PCR
SSR
PCR primers
Forward ATCAAGGACCTGTCACTCGG
Reverse CCCTTCCCTTAACAAAAGCC
SSR size
Expected 260
Amplification Conditions
Tm = 60C
Linkage Group
2A/2B
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09