Query (optional)   in Class  

GrainGenes Marker Report: Xgpw2259

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw2259
Type
Microsatellite
Chromosome
1A
Map
Wheat-Composite2004-1A60
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
GPW2259
Possible Orthologs
Xgpw2259-1A



Probe for Locus
GPW2259
Locus
Xgpw2259-1A
Xgpw2259
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (CCG)6
Type
PCR
SSR
PCR primers
Forward ACGTGCAAAAGGGTCAAAAC
Reverse GCGGCGAGTAAGATTAGGAG
SSR size
Expected 232
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum monococcum
Triticum aestivum
Data Source
Sourdille, Pierre2009.09