Query (optional)   in Class  

GrainGenes Marker Report: Xgpw2333-7A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw2333-7A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-7A225.4
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW2333
Possible Orthologs
Xgpw2333-2B



Probe for Locus
GPW2333
Locus
Xgpw2333-2B
Xgpw2333-7A
General Remarks
Motif (CA)21
Type
PCR
SSR
PCR primers
Forward ACAAGCCCAAAAGACACACA
Reverse ACATCACTTCCTCCGGTTTG
SSR size
Expected 227
Amplification Conditions
Tm = 60C
Linkage Group
2B
Source Species
Triticum monococcum
Data Source
Sourdille, Pierre2009.09