Query (optional)   in Class  

GrainGenes Marker Report: Xgpw304

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xgpw304
Type
Microsatellite
Chromosome
6D
Map
Wheat-Composite2004-6D86
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
GPW304
Possible Orthologs
Xgpw304-6D



Probe for Locus
GPW304
Locus
Xgpw304-6D
Xgpw304
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
General Remarks
Motif (TA)8(GT)13
Type
PCR
SSR
PCR primers
Forward GATCCAAGGTAGGAAAGGGG
Reverse AACTAGAGGGAGAGGGGTGC
SSR size
Expected 283
Amplification Conditions
Tm = 60C
Linkage Group
6D
Source Species
Aegilops tauschii
Triticum aestivum
Data Source
Sourdille, Pierre2009.09